# 187. Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

**Example:**

```
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"

Output: ["AAAAACCCCC", "CCCCCAAAAA"]
```

```cpp
// Hashmap
vector<string> findRepeatedDnaSequences(string s) { // time: O(n); space: O(n)
    unordered_map<string, int> mp;
    vector<string> res;
    string tmp;
    for (int i = 0; i + 9 < s.length(); ++i) {
        tmp = s.substr(i, 10);
        if (mp[tmp]++ == 1) res.emplace_back(tmp);
    }
    return res;
}
```

```cpp
// Hashset
vector<string> findRepeatedDnaSequences(string s) { // time: O(n); space: O(n)
    unordered_set<string> seen, repeated;
    vector<string> res;
    string tmp;
    for (int i = 0; i + 9 < s.length(); ++i) {
        tmp = s.substr(i, 10);
        if (seen.count(tmp)) repeated.insert(tmp);
        else seen.insert(tmp);
    }
    for (const string str : repeated) res.emplace_back(str);
    return res;
}
```

```cpp
// Bit Manipulation
vector<string> findRepeatedDnaSequences(string s) { // time: O(n); space: O(n)
    vector<string> res;
    unordered_set<int> seen, repeated;
    vector<int> char_map(26);
    // char_map['A' - 'A'] = 0; // 00
    char_map['C' - 'A'] = 1; // 01
    char_map['G' - 'A'] = 2; // 10
    char_map['T' - 'A'] = 3; // 11
    int hash_val = 0;
    for (int i = 0; i < s.length(); ++i) {
        hash_val <<= 2;
        hash_val |= char_map[s[i] - 'A'];
        hash_val &= 0xfffff; // f: 1111
        if (i < 9) continue;
        if (seen.count(hash_val)) {
            if (!repeated.count(hash_val)) {
                res.emplace_back(s.substr(i - 9, 10));
                repeated.insert(hash_val);
            }
        } else {
            seen.insert(hash_val);
        }
    }
    return res;
}
```


---

# Agent Instructions: Querying This Documentation

If you need additional information that is not directly available in this page, you can query the documentation dynamically by asking a question.

Perform an HTTP GET request on the current page URL with the `ask` query parameter:

```
GET https://jimmylin1991.gitbook.io/practice-of-algorithm-problems/bit-manipulation/187.-repeated-dna-sequences.md?ask=<question>
```

The question should be specific, self-contained, and written in natural language.
The response will contain a direct answer to the question and relevant excerpts and sources from the documentation.

Use this mechanism when the answer is not explicitly present in the current page, you need clarification or additional context, or you want to retrieve related documentation sections.
